mlst.net | Bhenselae.mlst.net
 
DATA ANALYSIS
DATABASES
B.burgdorferi
B.cereus
B.henselae
B.pseudomallei
C.albicans
C.glabrata
C.krusei
C.tropicalis
C.jejuni
C.neoformans var grubii
E.coli
E.faecalis
E.faecium
H.influenzae
H.pylori
Leptospira spp.
M.catarrhalis
N.meningitidis
S.agalactiae
S.aureus
S.dysgalactiae
S.enterica
S.epidermidis
S.pneumoniae
S.pyogenes
S.suis
V.vulnificus
SUBMISSIONS
NEWS
LINKS
 

Bartonella henselae Organism specific information

Introduction


Bartonella henselae infections are now recognised as being among the most common zoonoses acquired from companion animals in the developed world.  B. henselae is transmitted between cats by the cat flea Ctenocephalides felis. Humans can be infected with B. henselae by a scratch or bite from an infected cat. Infection can give rise to a wide range of clinical manifestations including, most commonly, cat scratch disease, which is characterised by a unilateral regional lymphadenopathy, and also persistent bacteraemia and fever, endocarditis and bacillary angiomatosis. Domestic and wild cat species serve as reservoir hosts for B. henselae, with the bacterium persisting within circulating erythrocytes; surveys of domestic cat populations around the world have shown an infection prevalence of, typically 5-20% in temperate regions, rising to 50% in warmer climates. Infections in humans are diagnosed on the basis of clinical presentation and/or using laboratory methods including serology and specific PCRs. Although isolation of B. henselae from cat blood is straight-forward, its recovery from infected human tissues is far more difficult. An MLST scheme for B. henselae was first described in 2003 (Iredell et al., 2003).

Iredell J,  Blanckenberg D, Arvand M, Grauling S, Feil EJ and Birtles RJ.  Characterization of the natural population of Bartonella henselae by multilocus sequence typing. Journal of Clinical Microbiology 2003;41:5071-5079.

Acknowledging the use of the MLST database in your publications
Please acknowledge the use of this site in your publications as follows: ‘We acknowledge the use of the Bartonella henselae MLST database which is located at Imperial College London and is funded by the Wellcome Trust’.

Primers used for MLST of B. henselae Genes 
The B. henselae MLST scheme uses internal fragments of the following seven house-keeping genes and 16s loci: 
16S rRNA (small subunit rRNA)
batR (regulatory protein of batR/S two component regulatory system)
ribC (riboflavin synthase)
groEL (Hsp60 chaperone)
gltA (citrate synthase)
nlpD (glycoprotein)
ftsZ (cell division protein)
rpoB (RNA polymerase beta subunit)

PCR Amplification of genes from isolates


The primer pairs used for the PCR amplification of internal fragments of these genes are:

gene

product size (bp)

forward primer
5'-3' sequence

reverse primer
5'-3' sequence

16S rDNA

472

AGAGTTTGATCCTGGYTCAG

CTTTACGCCCARTAAWTCCG

batR

487

GACCGCAATATTTTGACATC

GCATCCATCAAAGCATCACGACTT

ribC

283

AGCGAGGATCAAAACAAC

GCTCTTCAACACAATTAACG

groEL

369

GTTGATGATGCCTTGAAC

TGGTGTGTCTTTCTTTGG

gltA

338

GGGGACCAGCTCATGGTGG

AATGCAAAAAGAACAGTAAACA

nlpD

494

GGCGCTGGTATGATACAA

GACATCTGTGCGGAAGAA

ftsZ

483

GCCTTCTCATCCTCAACTTC

CTTTGTTTTAAACGCTGCC

rpoB

471

CTGGACGTACATCCTACA

AACAGCAGCTCCTGAATC

PCR Conditions for MLST housekeeping genes


Amplification of each of the MLST housekeeping genes from isolates is carried out using a single round PCR assay that amplifies a fragment of each of the loci in the table above. Each reaction mixture comprised 12.5 µl of 2xPCR mastermix (Abgene), 0.5 µl of a 20 ρmol μl-1 solution of both forward and reverse primers, 10.5 µl sterile, distilled water and 1 µl of bacterial cell suspension. Reaction mixtures are exposed to a thermal cycle consisting of 96°C for 5 min followed by 40 cycles of 96 °C for 10 sec, 55 °C for 10 sec and 72 °C for 50 sec, with a final extension step of 72 °C for 10 minutes.

Due to the difficulty in obtaining isolates of B. henselae from humans, alternative primers have been suggested in the table below for use in the first round of a nested PCR to allow amplification of the loci from human clinical DNA extracts. The second round primers are the primers from the original B. henselae MLST scheme.  Reaction mixes and thermal cycling conditions are the same as those described above, with 1 µl of 1st round post-amplification PCR mix being incorporated as template into a second round reaction mix.

 

gene

nested PCR round

forward primer 5’-3’ sequence

reverse primer 5’-3’
sequence

16S rDNA

1st

CAATATGAGAGTTTGATCCTG

ACCTCTGACTTAAATATCCG

2nd

AGAGTTTGATCCTGGYTCAG

CTTTACGCCCARTAAWTCCG

batR

1st

CGATTGTACTTGTTGATGATG

ATGTACAGGTGTGACGTTCTT

2nd

GACCGCAATATTTTGACATC

GCATCCATCAAAGCATCACGACTT

ribC

1st

GTGTTCAGGAGTTTGTCTAA

GGCGAATAATAAGAACATCG

2nd

AGCGAGGATCAAAACAAC

GCTCTTCAACACAATTAACG

nlpD

1st

GGATTCTCCAACATTGTCAT

CTTTATTCATCACGGTATC

2nd

GGCGCTGGTATGATACAA

GACATCTGTGCGGAAGAA

groEL

1st

GCAACAGAAGTTGAAGTGAA

AGGCACTGGTGTGTCTTTCT

2nd

GTTGATGATGCCTTGAAC

TGGTGTGTCTTTCTTTGG

gltA

1st

TCAGGTGCTAATCCATTTGCA

ATTTCTTTCCATTGCGCAAC

2nd

GGGGACCAGCTCATGGTGG

AATGCAAAAAGAACAGTAAACA

ftsZ

1st

TCGTGAGGTTAGTGATTTAG

CCTCTTCACGATGTGTCAAA

2nd

GCCTTCTCATCCTCAACTTC

CTTTGTTTTAAACGCTGCC

rpoB

1st

AAATTACCCATAAGCGGCGT

ATCAACAATACCACTACGCCT

2nd

CTGGACGTACATCCTACA

AACAGCAGCTCCTGAATC


 

 

 

 

 

 

 

 

Sequencing


The same primer pairs as used for amplification (or the second round of amplification when nested PCRs are employed are also used for sequencing.

 Submitting your data to the MLST database


The initial database contains the profiles of 163 isolates and will be updated with new profiles at intervals. Those performing MLST on this species are encouraged to submit their data to the curator (G. Chaloner) so that the strain details can be added to the database.


Submitting a new allele


Please send (preferably by email) two sequence trace files (one in each direction; note: these do not have to be edited) for the new allele to the database curator, along with the trimmed sequence (in a text file or within the body of the email) of the proposed new allele. 

Upon visual inspection of the trace files the curator will assign an allele number and enter the sequence of the new allele into the database.  If the curator feels the trace files do not clearly show the identity of the unique nucleotide(s) a number will not be assigned.  The curator will contact you explaining the reasons why this allele was not accepted and give you the opportunity to submit another trace file for this allele.

Submitting a new allelic profile


To be assigned with a new ST designation you should submit the allelic profile and information on a representative strain with epidemiological data to the database curator, who will enter it in the MLST database and assign an ST number.  If the new allelic profile contains a new allele, sequence trace files need to be sent to the curator as described above.

It should be noted that submission of a new ST which is a novel combination of known alleles does not require the submission of sequence trace files.  There is, of course, the potential that one of these alleles has been sequenced incorrectly and the onus is on the submitter to ensure that the allelic profile is correct.  It is strongly recommended that if a new ST is identified that varies at only a single locus from a previously identified ST, sequencing of this variant locus is repeated. 

If you are submitting information on a number of strains at one time, a template excel form is available which can be used for submissions.  The template can be obtained from the database curator.

Submitting strain information


Investigators are strongly encouraged to submit ST and strain information on all their isolates, not just ones with new STs.  The database will be of most use to researchers if as much information as possible on as many isolates as possible is included. 

To submit information on isolates with previously reported STs a template excel form can be used.  This form can be obtained from the database curator.

 


 
Profile Query

 
Locus Query

Batch Query